(2004). The regions located directly upstream and downstream from bc1245 were amplified from B. cereus ATCC 14579 using the following primer pairs, respectively: TCAAGAATTCCAGTATTTGGCTTCACTC/TATGGAATTCGTAAAGAGTATGTAAAAA and ATAAGGATCCTCTCTATACCAAGACTGT/GAATGGATCCGAAATTGATAAGACAGAT (restriction sites underlined). The fragments were inserted into the pMAD vector on either side of spc, producing

the pMADΔbc1245 plasmid and the directions of the inserts were verified by PCR. The pMADΔbc1245 plasmid was introduced into B. cereus ATCC 14579 by electroporation (Masson et al., 1989), and the bc1245 deletion mutant was obtained as described by Arnaud et al. (2004). Replacement of bc1245 Talazoparib in vivo this website by spc was verified by sequencing of PCR products using the primer pairs TCAAGCATATTCAGTCCAGCA/ATTGAATGGACTAATGAAAATGTAAA

and GAGAGTTTAACGCCTCTATTTTCA/TGATATGATCTTTCATTTCCATAAAAC, respectively. Bacteria were sporulated either using the MSM (van der Voort et al., 2010) or a chemically defined sporulation medium (de Vries et al., 2004). Sporulation was continued until ≥ 90% phase bright spores were observed by phase contrast microscopy (~ 1–2 days after incubation in sporulation medium). Spores were harvested by centrifugation for 10 min at 8000 g at 4 °C, prior to resuspension in 10 mL cold autoclaved MQ with 0.1% Tween for MSM spores or 10 mM K-phosphate buffer pH 7.2 for spores made in chemically defined medium. Spores were washed by centrifugation and resuspension in MQ with

0.1% Tween or 10 mM K-phosphate buffer pH 7.2 a total of ten times. The resulting spore crops contained < 10% germinated spores (observed as phase-dark spores by phase-contrast microscopy) and were stored refrigerated in MQ (0.1% Tween) or 10 mM K-phosphate buffer pH 7.2. Germination assays were performed as described earlier (Hornstra et al., 2005) by monitoring the reduction in absorbance at A600 as spores turn from phase bright to phase dark Inositol oxygenase at 30 °C in a 96-well microplate in a plate reader (Tecan Infinite M200, Grödig, Austria). Heat-activated (70 °C, 15 min) and non-heat-activated spores prepared in MSM were adjusted to an initial A600 nm of ~ 2 (Shimadzu UV-VIS 160A;Shimadzu Europa GMBH) in germination buffer (final concentration in the assay 10 mM Tris pH 7.4 10 mM NaCl) prior to addition of germinant. Germinants tested were 100 and 1 mM l-alanine, 10 and 1 mM inosine, a combination of 100 or 1 mM l-alanine and 10 or 1 mM inosine, 1 mM cysteine, 1 mM threonine and 1 mM glutamine. Outgrowth was monitored for non-heat-activated spores prepared in chemically defined sporulation medium by absorbance readings at 30 °C for 24 h as described previously. Germination/outgrowth medium was 1/2× Brain Heart Infusion (BHI) broth 10 mM Tris 10 mM NaCl pH 7.4.