Table 1 Primers and probes for multiplex qPCR Organism Target Oli

Table 1 Primers and probes for multiplex qPCR Organism Target Oligo function Oligo name Sequence 5′-3′ a B. anthracis sspE Forward primer spEpri_f CGACTGAAACAAATGTACAAGCAGTA     Reverse primer spEpri_r CGTCTGTTTCAGTTGCAAATTCTG     Probe Tqpro_spE FAM-TGCTAGCATTCAAAGCACAAATGCTAGTT-BHQ1   cya Forward primer cyapri_f AGGTAGATTTATAGAAAAAAACATTACGGG     Reverse primer cyapri_r GCTGACGTAGGGATGGTATT     Probe Tqpro_cya JOE-CCACTCAATATAAGCTTTATTACCAGGAGC-BHQ1   capB Forward primer caBpri2_f AGCAAATGTTGGAGTGATTGTAAATG     Reverse primer caBpri2_r AAAGTAATCCAAGTATTCACTTTCAATAG     Probe Tqpro_caB CFR590-AGGTCCCATAACATCCATATGATCTTCTAA-BHQ2 F. tularensis fopA Forward primer foApri_f GCGCTTTGACTAACAAGGACA     Reverse primer foApri_r CCAGCACCTGATGGAGAGTT

Vadimezan chemical structure AZD5582 concentration     Probe Tqpro_foA FAM-TGGCCAGTGGTACTTAGGTGTAGATGCTA-BHQ1

  ISFtu2 Forward primer isfpri2_f CAAGCAATTGGTAGATCAGTTGG     Reverse primer isfpri2_r GACAACAATATTTCTATTGGATTACCTAAA     Probe Tqpro_isf JOE-ACCACTAAAATCCATGCTATGACTGATG-BHQ1   pdpD Forward primer pdDpri_f TCAATGGCTCAGAGACATCAATTAAAAGAA     Reverse primer pdDpri_r CACAGCTCCAAGAGTACTATTTCC     Probe Tqpro_pdD CFR590-ACCAAATCAAAATCCTGCTGAGCAGA-BHQ2 Y. pestis ypo393 Forward primer yp93pri_f AGATAGTGTGACTGGTCTTGTTTCA     Reverse primer yp93pri_r AGATGCAGATTGTATTGTAAACAATGAC     Probe Tqpro_yp93 FAM-ACTTCCTGATATATTGGAAATCTTCTTCTC-BHQ1   caf1 Forward primer cafpri_f CCAGCCCGCATCACT     Reverse primer cafpri_r ATCTGTAAAGTTAACAGATGTGCTAGT     Probe Tqpro_caf JOE-AGCGTACCAACAAGTAATTCTGTATCGATG-BHQ1   pla Forward primer ADAMTS5 plapri_f ATGAGAGATCTTACTTTCCGTGAGAA     Reverse primer plapri_r GACTTTGGCATTAGGTGTGACATA     Probe Tqpro_pla CFR590-TCCGGCTCACGTTATTATGGTACCG-BHQ2 B. thuringiensis cry1 Forward primer crypri_f GCAACTATGAGTAGTGGGAGTAATTTAC     Reverse primer crypri_r TTCATTGCCTGAATTGAAGACATGAG     Probe Tqpro_cry Cy5-ACGTAAATACACT-BHQ2-TGATCCATTTGAAAAG-P a CFR590 = CALFluor Red 590, BHQ = Black Hole quencher, P = phosporylation In order to achieve a

reliable as well as rapid method for the detection of B. anthracis, Y. pestis and F. tularensis, the cry1 gene from B. thuringiensis was VX-680 included in the multiplex qPCR assays. Inclusion of this gene permitted the development of B. thuringiensis spores as internal control for DNA extraction as well as amplification. The amount of spores that must be added to the samples before DNA extraction to obtain the desired Cq value was determined from serial dilutions of the spores. Specificity and coverage of strain diversity A DNA panel from the Bacterial and Eukaryal species listed in Additional file 1 Table S1 was used to validate the specificity of the developed real-time qPCR assays. The pathogen-specific targets showed no cross-reactivity and very near relatives could be differentiated as evidenced by the absence of amplification from various members of the Bacillus cereus group, Yersinia pseudotuberculosis, Y. enterocolitica and Francisella philomiragia.

Leave a Reply

Your email address will not be published. Required fields are marked *

*

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>