A class of nanomaterials that display these characteristics is amorphous semiconductors [1]. Generally, amorphous semiconducting nanostructures display some advantageous electrical characteristics compared with their crystalline counterparts. In particular, due to their disordered structure,

amorphous materials typically have a high density of localized defect states, resulting in significant charge trapping and much lower leakage current [2]. Moreover, amorphous nanomaterials can be produced at relatively low temperatures, while a lower strain is expected between the embedded nanoparticles and the matrix due to their flexible amorphous structure [3]. In addition, very recent works have demonstrated that some amorphous or polycrystalline nitrides, like CuN, AlN, and NiN, #check details randurls[1|1|,|CHEM1|]# exhibit resistive switching behavior capable for fabricating resistance-switching random access memory devices [4–7]. However, the research for switching resistive materials had been focused almost only on metal oxides, e.g., TiO2[8, 9], NiO [10, 11], ZnO [12], and Ta2O5[13–16], as their electrical properties are well known and their preparation methods are relatively easy and well established. On the contrary, metal nitrides, even though they exhibit intriguing electrical properties, remain largely unexplored in this field. Low-power

memristive behavior with outstanding endurance has been already demonstrated in tantalum oxide QNZ in vivo [13–15], alongside with efforts to maximize its performance with nitrogen doping [16]. A promising material in this point of view is amorphous tantalum nitride (a-TaN x ). Tantalum nitride is proved to be a mechanically hard and a chemically inert material, combining both high thermal stability and low temperature coefficient of resistance [17, 18]. TaN x appears

with many crystalline phases that are well studied [19, 20]. For example, the metallic TaN may have potential applications as Cu diffusion barriers [21], enough thin film resistors [22], and superconducting single-photon detectors [23], while nitrogen-rich Ta3N5 is used as photocatalytic material for water splitting [24, 25]. On the other hand, the amorphous phase (a-TaN x ), which is the most common phase of the as-prepared TaN x at relatively low temperatures [26–28], has received very low attention. Early electrical studies on a-TaN x films by Chang et al. showed that there was increasing resistivity of films, as the nitrogen concentration in the gas environment increased [29], while Kim et al. [30] indicated that a-TaN x could prevent copper diffusion more effectively than the crystallized Ta2N film by eliminating grain boundaries. It is well known for 1-D and 2-D nanostructures, i.e.

Current monitoring techniques, such as MUGA (Multi Gated Acquisition Scan) or echocardiography, have

substantial limitations and detect LV dysfunction only after it had AZD8931 occurred. Cardiotoxicity is usually diagnosed only upon manifestation of clinical signs and symptoms or progressive cardiac dysfunction. Thus new diagnostic tests are required to confirm ventricular dysfunction induced by anticancer therapy . Novel echocardiographic techniques are promising in evaluating the presence of myocardial structural alterations and subtle myocardial dysfunction induced by anticancer therapy, yet they are not used in routine clinical practice. Although new cardiac imaging techniques, such as quantitative assessment of ventricular function through measurement of myocardial strain and strain rate can Dinaciclib concentration more precisely assess heart structure and function during and early after cardiotoxic therapy, it remains to be proven whether they have the ability to detect early treatment-induced cardiac Danusertib cost injury in long-term cancer survivors several years after completion of malignancy therapy. Morevover, the definition of reference range of ventricular strain and

strain rate values in normal adults and description of the variability among systems and observers are debatable [10, 11]. Early and accurate diagnosis of ventricular dysfunction in asymptomatic cardiac patients may permit a prompt onset of therapy of subclinical cardiotoxicity before the development of life-threatening complications. This study aims to detect cardiac abnormalities using plasma N-terminal pro brain natriuretic peptide (NTproBNP) and echocardiography in asymptomatic childhood leukemia survivors treated with or without cardiotoxic anthracyclines (ANT). Methods

Childhood acute leukemia survivors without any cardiac symptoms were consecutively recruited in the out-patient clinic of Thalidomide the National Cancer Institute, Bratislava, Slovak Republic, from January 2006 to October 2010. A total of 69 survivors of acute leukemia were involved, aged 17–31 years, whose chemotherapy completion dated back for at least 5 years. They had been treated between 1985 and 2005 in a single center – at the Children´s University Hospital, Bratislava. Survivors were divided into two treatment groups: 36 patients who had received chemotherapy containing cardiotoxic anthracyclines (ANT) and 33 patients after chemotherapy without anthracyclines (nonANT) (Table 1). Only one patient was treated with ANT in combination with mediastinal radiation. Table 1 Characteristics of the study participants   ANTgroup (N=36) NonANT group (N=33) Control group (N=44) Sex M/F 19/17 16/17 22/22 Diagnosis ALL (33) ALL (33)   (No.

Cuphophyllus acutoides from the eastern USA is related to the European C. fornicatus. Hygrocybe clivalis (Fr.) P.D. Orton & Watling was originally described as a variety of Hygrophorus fornicatus Fr., and is currently considered as such by most authors (Arnolds 1985b, Bon 1989, Boertmann 2010). A collection from the UK identified by E. Arnolds as selleck screening library H. fornicata var. clivalis, however, JQEZ5 appears with a second UK collection in a distinct, highly supported clade in Dentinger et al.’s ITS analysis (100 % MLBS), supporting recognition at of H. clivalis at species rank. Hygrocybe fornicatus var. lepidopus (Rea) Boertm. & Barden is also currently recognized by most authors as a variety, but

a collection from the UK identified as H. lepidopus (Rea) P.D. Orton &

Watling appears in a separate, highly supported (100 % MLBS) clade in the ITS analysis by Dentinger et al. (unpublished), and if confirmed, RG7420 cell line this taxon should also be recognized at species rank. Cuphophyllus , sect. Adonidum (Singer) Lodge & M.E. Sm., comb. nov. MycoBank MB804136. ≡ Cuphophyllus adonis (Singer) Lodge & M.E. Sm., comb. nov. Basionym: Camarophyllus sect. Adonidum (as Adonidi) Singer, Sydowia Beih. 7: 2 (1973). Type species: Camarophyllus adonis Singer, Sydowia 6(1–4): 172 (1952) Characters as in Cuphophyllus; basidiomes clitocyboid; pileus surface dry; pileus and lamellae pigmented violet, lilac or mauve; stipe white, cream or yellow; basidiospore Q mostly 1.1–1.5; ratio of basidia to basidiospore length 6.5–8; pileipellis a cutis, not an ixocutis. Phylogenetic support Only the type species has been sequenced, so phylogenetic support is irrelevant. There is no significant support for placing C. adonis as

sister to sect. Cuphophyllus in our Supermatrix, or as sister to the unplaced C. basidiosus—C. canescens—C. griseorufescens clade in our ITS-LSU analysis (Figs. 2 and 22 , respectively). Species included Type Cuphophyllus adonis. Hygrocybe cheelii A.M. Young and H. reesiae A.M. Young from Australia are placed in sect. Adonidum based on morphology and pigments. Comments Sect. Janus kinase (JAK) Adonidum most closely resembles sect. Cuphophyllus except for having violet and lilac rather than salmon and reddish brown pigments. These two sections share robust basidiomes with a dry pileus surface; lamellae that are thick and appear opaque from the refractive, interwoven context hyphae, subglobose to broadly ellipsoid spores, and long basidia relative to the length of the spores. Sects. Adonidum and Cuphophyllus may eventually be assigned to the same subgenus, possibly together with C. aurantius, and possibly also C. basidiosus, C. griseorufescens and C. canescens, but branch supports in our Supermatrix and ITS-LSU analyses are weak and the topology varies among analyses. Cuphophyllus sect. Cuphophyllus [autonym] Type species: Cuphophyllus pratensis (Fr.) Bon, Doc.

In EPZ015938 ic50 patients with a CKD-EPI ≥80 mL/min/1.73 m2, dabigatran was associated with a lower major Lazertinib clinical trial bleeding rate in comparison with warfarin (p ≤ 0.005), whereas this was not demonstrable in patients with CG ≥80 mL/min (p ≥ 0.061) [53]. Further, they reported that around 50 % of the dabigatran patients who were classified as having a creatinine clearance ≥80 mL/min according to the CG equation had a GFR ≤80 mL/min/1.73 m2 according to the CKD-EPI equation.

Hijazi et al. [53] thus propose that the CKD-EPI equation is better than the CG equation at identifying patients with normal or ‘enhanced’ renal function, in whom the risk of major bleeding is lower for a given dose rate of dabigatran etexilate. In our study we also observed a greater, albeit non-significant, correlation with the creatinine-only CKD-EPI equation compared with the CG equation for trough dabigatran concentrations (Table 5). Contemporary renal function equations featuring cystatin C have demonstrated Foretinib nmr similar or superior performance to equations employing creatinine [30, 31].

We therefore sought to examine those cystatin C-based GFR equations that had been developed using an internationally standardised cystatin C assay [28]. These include two cystatin C-based equations developed by the CKD-EPI group [30]. We did not assess the Berlin Initiative Study (BIS) equation because it was specifically designed for individuals aged ≥70 years,

of which we had few patients [31]. While the 95 % CI of the R 2 of the four equations overlapped (Table 5), the CKD-EPI equation featuring both creatinine and cystatin C Amobarbital was numerically associated with the highest R 2. This is in agreement with the findings of the CKD-EPI and BIS groups, who found that the equations that employed both renal biomarkers were superior to those using either biomarker alone for estimating GFR [30, 31]. Two of the non-renal covariates that appear to have the largest impact on plasma cystatin C concentrations are glucocorticoid therapy and thyroid dysfunction [46]. None of our study population received glucocorticoid therapy. When patients with thyroid test abnormalities were excluded, there was no significant change in the results. This may reflect the mild nature of the test abnormalities, as evidenced by free thyroxine concentrations within the ‘normal’ reference range. The agreement in simulated dabigatran etexilate dosing recommendations between the four GFR equations was high for our cohort (94–98 %, Table 7). This finding is predictable given that ≥92 % of our study participants had estimated GFR >50 mL/min, with a median GFR of around 90 mL/min (Table 3). The majority of differences in estimated GFR between the four equations were thus away from the 50 mL/min threshold for dose reduction, and would not be expected to contribute to discordance in dosing recommendations.

1993; Kaltenbach 2007; Moreira and Martins 2005). Phytophthora species have also been identified as pathogens causing dieback in oak-trees in central Europe (Jung et al. 2000). The chestnut bark fungus Selleckchem PR171 Endothia parasitica has led to a sharp decline of Castanea groves, especially in Italy and southern France, including former and present pastoral woodlands. Removal of olive find protocol groves and streuobst meadows Groves with old olive-trees have been a

characteristic feature of the Mediterranean cultural landscape, often used in multiple ways including wood-pasture. The pasturelands underneath the ancient olive-trees can be very rich in species, especially orchids and other bulbous plants. In the last 2 decades, major parts of old stands were cut and substituted by olive-plantations of high-yield varieties. Plantations have also been established in former fields and wood-pastures, especially in southern mainland and insular Greece, Italy and Spain. These plantations are generally ploughed, irrigated and pesticides are applied. OSI-906 cost Streuobst meadows with standard apple and pear trees have been and are still a common sight in Germany and elsewhere in temperate Europe on the outskirts of villages. In the course of reallocation

of farming lands and rural development, there has been a substantial loss of trees and conversion to silage grasslands, fields and development areas. If still extant, the grassland underneath is commonly fertilized and no longer part of low-input

grazing or hay-making systems. Wood-pasture in the EU Habitats Directive Pros and cons Due to its multifunctionality and broad range of ecosystem services, wood-pasture systems have received increasing attention by scientists and policy-makers concerned with agriculture and forestry, but also in the fields of rural development, tourism and nature conservation (Mattison and Norris 2005; Rigueiro-Rodríguez et al. 2009; Terzi and Marvulli 2006). The Habitats Directive (Council of the European Communities 1992) is a legislative instrument of the European Community in the field of nature conservation. Fludarabine The aims of the Directive are to maintain and restore favourable conservation status of natural habitats and of wild fauna and flora of Community interest. A “coherent ecological network of special areas of conservation”—Natura 2000—has been established “hosting the natural habitat types listed in Annex I and of the species listed in Annex II…” (art. 3). Among the 231 European natural habitat types listed in Annex I (European Commission 2007), very few are related to wood-pasture.

All primary antibodies were preabsorbed with a bacterial lysate containing GST alone before use. In addition, for some experiments, the primary antibodies were absorbed with either the corresponding or heterologous

fusion proteins immobilized onto glutathione-conjugated agarose beads (Pharmacia). The absorption was carried out by incubating the antibodies with bead-immobilized antigens for 1 h at room temperature (RT) or overnight at 4°C PI3K inhibitor followed by pelleting the beads. The remaining supernatants were used for immunostaining. The immunofluorescence images were acquired using an Olympus AX-70 fluorescence microscope equipped with multiple filter sets and Simple PCI imaging software (Olympus, Melville, NY) as described previously [40]. An Olympus FluoView laser confocal microscope (Olympus, Center Valley, PA) was used to further analyze some of the immunofluorescence

samples at the University of Texas Health Science Center at San Antonio institutional core facility as described previously [29]. The images were processed using Adobe Photoshop (Adobe Systems, San Jose, CA). 4. Western blot assay The Western blot assay was carried out as described elsewhere [38, 55]. Briefly, HeLa cells with or without C. trachomatis infection and with or without fractionation (into pellet and S100 fractions), purified chlamydial RB and EB organisms, GST fusion proteins or fractionated bacterial periplasmic or cytosolic samples were resolved in SDS polyacrylamide gels. The resolved protein bands were transferred to nitrocellulose membranes LY333531 in vivo Sodium butyrate for antibody detection. The primary antibodies used included: mouse pAb and mAb 6A2 against cHtrA, mouse pAb against CT067 (all Selleck AZD5363 current study), mAb 100a against CPAF [26], mAb MC22 against chlamydial major outer membrane protein [MOMP; ref [26]], mAb W27 against host cell HSP70 (cat#Sc-24, Santa Cruz Biotechnology, CA), mAb against FLAG tag (cat#F3165, Sigma, St. Luis, MO) and rabbit polyclonal antibody against bacterial GroEL (cat#G6532, Sigma, St. Luis, MO). The anti-MOMP antibody was used to ensure that all lanes with chlamydial organism-containing samples were loaded with equivalent amounts of the organisms

while the lanes without chlamydial organism samples should be negative for MOMP. The anti-HSP70 antibody was used to make sure that equal amounts of normal HeLa and Chlamydia-infected HeLa samples were loaded and to also check whether the cytosolic fractions are contaminated with components from the pellet fractions during cellular fractionation (see below). All primary antibodies used in the current study were pre-absorbed with an excess amount of bacterial lysates containing the GST alone. The primary antibody binding was probed with an HRP (horse radish peroxidase)-conjugated goat anti-mouse IgG secondary antibody (Jackson ImmunoResearch, West Grove, PA) and visualized with an enhanced chemiluminescence (ECL) kit (Santa Cruz Biotech). Some of the C.

Stem-loop conventional RT-PCR assay Total RNA was extracted using TRIzol reagent (Invitrogen, USA). Reverse-transcribed complementary DNA was synthesized with the Prime-Script RT reagent Kit (TaKaRa, Dalian, China). Conventional PCR was used to assay miRNA expression with the specific forward primers and the universal reverse primer complementary to the anchor primer.

U6 was used as internal control (Invitrogen, USA). The PCR primers for mature miR-451 or U6 were designed as follows: miR-451 sense, 5′- ACACTCCAGCTGGGAAACCGTTACCATTACT -3′ and reverse, 5′- CTGGTGTCGTGGAGTCGGCAA -3′. U6 sense, 5′- CTCGCTTCGGCAGCACA -3′ and reverse, 5′- AACGCTTCACGAATTTGCGT -3′. Then, the RT-PCR products were electrophoresed #this website randurls[1|1|,|CHEM1|]# through a 1.5% agarose gel with ethidium bromide. Signals were quantified by densitometric analysis using the Labworks Image Acquisition (UVP, Inc., Upland, CA). Western Blot assay Thirty micrograms of protein extract were separated in a 15% SDS-polyacrylamide gel and electrophoretically transferred onto a PDVF membrane (Millipore, Netherlands). Membranes were blocked overnight with 5% non-fat dried milk and incubated for 2 h with antibodies to phospharylated Akt (pAkt-473), total Akt, Bcl-2 and Bax (Santa Cruz Biotechnology, buy BKM120 Santa Cruz, CA) and GAPDH (Sigma, USA).

After washing with TBST (10 mM Tris, pH 8.0, 150 mMNaCl, and 0.1% Tween 20), the membranes were incubated for 1 h with horseradish peroxidase-linked

goat-anti-rabbit antibody. The membranes were washed again with TBST, and the proteins were visualized using ECL chemiluminescence and exposed to x-ray film. 3-(4,5-dimethylthazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay The mock or stably transfected A549 cells were seeded into 96-well plates (6.0 × 103 cells/well) and allowed to attach overnight. After cellular adhesion, freshly prepared anticancer drugs (DDP) were added with various concentrations. After 72 h, cell viability was assessed using MTT assay. The absorbance at 490 nm (A490) of each well was read on a spectrophotometer. selleck chemical Three independent experiments were performed in quadruplicate. Colony formation assay Approximately 500 mock A549 or stable transfect A549 cells (A549/miR-451 and A549/miR-NC) were placed in a fresh 6-well plate with or without DDP for another 12 h and maintained in RMPI 1640 containing 10% FBS for 2 weeks. Colonies were fixed with methanol and stained with 0.1% crystal violet in 20% methanol for 15 min. Flow cytometry analysis of apoptosis Cells were treated with or without DDP for another 12 h and harvested and fixed with 2.5% glutaraldehyde for 30 minutes. After routine embedment and section, the cells were observed under electronic microscope.

The resulting sponge-like matrix possesses a very large specific surface area (up to 300 m2/cm3): gases and liquids can easily get into pores, thus changing the optical, chemical and electrical properties of PSi [6]. Even if electrochemical etching induces silicon dissolution, the resulting PSi surface is smooth enough to get very good quality optical devices, also in the case of multilayered structures [7]. Periodic, or quasi-periodic, alternation of high- and low-porosity layers is used for fabrication of Bragg reflectors, microcavities and Thue-Morse sequences: all these photonic devices exhibit resonance

wavelengths that can be used as monitoring peak in quantifying biomolecular interaction from the optical point of view [8–10]. The PSi surface can be properly passivated #AZD1480 randurls[1|1|,|CHEM1|]# and functionalized in order to covalently bind biological molecules such as single- or double-stranded

DNA, proteins, enzymes, antibodies, aptamers and S63845 order so on, which act as bioprobes. There are many routes to achieve surface functionalization which are based on proper chemical or biological processes: the PSi surface can be activated by specific chemical groups, namely -SH, -NH2 or -COOH, that could form very stable bonds, such as sulphide or peptide bond, with the biological molecule considered [11]. For some biomolecules that are usually synthesized ex situ and then coupled on the PSi surface, there is also the possibility of directly growing the molecules using PSi as support in the so-called solid-phase synthesis [12]. In this article, we describe the fabrication and the characterization of a PSi-based DNA chip for biochemical optical sensing through in situ mixed-sequence ON growth. Since the chemistry used for the solid-phase synthesis of ON can be quite aggressive against the PSi solid support, the chemical stability of PSi supports

Montelukast Sodium is a key issue that must be checked and satisfied for each considered substrate. In particular, it is well known that PSi suffers upon exposure to alkaline solutions (commonly used for the deprotection of nucleobases) that can easily corrode the silicon skeleton, so a trade-off between PSi surface passivation and suitable solid-phase synthesis chemistry must be found. We focused our studies on silanization of PSi by using two different siloxanes and also on the exploitation of different chemical approaches for the ON deprotection in order to preserve the stability of PSi during all phases of synthesis and sensing. Methods Mesoporous silicon microcavity fabrication PSi microcavities constituted by a λ/2 layer (optical thickness) sandwiched between two 9.5-period Bragg reflectors (BRs) were obtained alternating low (L) and high (H) refractive index layers whose thicknesses satisfy the Bragg relationship n H d H + n L d L = mλ B/2, where m is an integer and λ B is the Bragg wavelength. The microcavities were prepared by electrochemical etching of highly doped p+ crystalline silicon (0.

The products were transformed into DH5α competent cells. Ampicillin-resistant colonies were chosen, identified by restriction digestion and further confirmed by DNA sequencing. SGC7901 cells were planted in six-well plates and selleck cultured in drug-free medium. At 90-95% confluence, cells were washed twice with PBS, grew in 2 ml of DMEM without antibiotics. Using Lipofectamine™ 2000 reagent (Invitrogen, Inc. Carlsbad CA), 2 μg of mU6pro-COX-2siRNA plasmids were transfected into cells according to the manufacturer’s instructions. The cells transfected with mU6pro vector alone were served as negative control. Forty-eight hours later, cells were placed in growth medium containing G418

(GIBCO) for clone selection. The expression PF-573228 in vitro levels of COX-2 in G418-resistant clones were evaluated by western blot analysis. RT-PCR All of the PCR products were separated on ethidium bromide stained agarose, and visualized with UV as described previously [6]. Western blot analysis The western blot was done as described previously. In brief, total cellular proteins were prepared and then quantified by Bradford method [7]. A measure of 80 ug of lysates were electrophoresed in 12% Selleckchem MK-0457 SDS-PAGE and blotted

on a nitrocellulose membrane (Immoblin-P, Millipore, Bedford, MA, USA). Membranes were blocked with 5% fat-free milk powder at room temperature and incubated overnight with antibody at 4°C. After three washes for 15 min in PBS-T, the membrane was incubated with the HRP-conjugated goat anti-mouse IgG antibody (Wuhan, Hubei, China) for 1 h at room temperature. The enhanced chemiluminescence (Amersham Life Science, Piscataway, NJ, USA) was added and monitored for the development of color. Cell growth assay Cells were seeded on a 96-well plate at 3 × 104 cells/well. Each sample had four replicates. The medium was replaced at 2-day intervals. Viable cells were counted by the 3-[4,5-dimethylthiazol-2-yl]- 2,5-diphenyltetrazolium bromide (MTT) assay after 2, 4, 6, and 8 days. Tumor growth in nude mice Female athymic nu/nu mice, 5-6 weeks of age, were obtained

from FMMU Experimental Animal Co. (Shaanxi, China) and housed in a pathogen-free facility for all of the experiments. The logarithmically growing cells were trypsinized and resuspended Selleck Enzalutamide in D’Hanks solution, and 5 × 106 cells in 0.2 ml were injected subcutaneously into the left flank of mice [8]. Experimental and control groups had at least 6 mice each. Tumors were measured twice weekly with microcalipers, and the tumor volume was calculated according to the formula: volume = length × (width2)/2. Quantification of tumor microvessel density Tumor microvessel densities (MVD) were quantified by anti-CD31 immunohistochemistry. Briefly, tumor sections from nude mice were cut using a LEICA cryostat and the paraffin sections were mounted on positively charged Superfrost slides and dried overnight. The immunostaining was done according to standardized protocols.

The graphical output from the BRIG analysis comparing the genomes to the Corby sequence displays an overview of the major regions of variability among these genomes such that 14 regions of substantial variation were observed (Figure  5 and Additional file 1: Table S1). Many of the genes present in these regions are phage or transposable-element associated, suggesting selleckchem that much of this variability is driven by

mobile elements. Many of these regions are adjacent to or have a tRNA sequence within them, a common location for mobile element integration [39]. Several of the variable regions have genes involved in a conjugation/type IV secretion system (T4SS). The excision, transfer and re-integration of genetic loci by this class of genes has been implicated in HGT [34]. Variability p38 MAPK activity in T4SS genes has been shown previously to be a major contributor to the genome plasticity of L. pneumophila[23]. Other classes of genes include those encoding transporter/eflux proteins, proteins

involved in glycosylation, putative virulence proteins, restriction endonuclease system proteins, and antibiotic resistance proteins. None of these proteins are involved in core metabolic functions and variability in the presence and absence of these genes is likely to result in phenotypic changes that alter the ability of the organism to survive within its environment. Plasmid analysis Apart from acquisition of genomic islands another common way that bacteria gain genetic elements that confer phenotypic differences is by plasmid

acquisition. In order to investigate the presence of plasmids in the genomes the plasmids of the Lens and Paris genomes were compared. A shared 9.2 kb region was used to query both the assembled and GenBank genomes. Although there may be plasmids circulating in the population that do not contain this shared locus, the same sequence is also present in the plasmid of another Legionella species, Legionella longbeachae (NSW150 plasmid pLLO: Accession FN650141) suggesting that this is a conserved sequence present in at least some of plasmids of the Legionella genus. Blast analysis detected this conserved plasmid sequence in a small proportion of the Fludarabine in vivo strains (8/33) and the these plasmids sequence itself was variable. The following genomes produced a hit whose e-score was less than 1×10-20: Lens: (100% identity over 9299 bases), Paris: (83% identity over 8319 bases), ST154: (83% identity over 7270 bases), ST336: (83% identity over 7270 bases), ST44: (88% identity over 249 bases), ST54: (99% identity over 9299 bases), ST707: (83% identity over 7373 bases), ST74: (82% identity over 8239 bases), ST78: (83% identity over 7323 bases). It can be seen that there are some closely related strains (ST 154 and 336 in the same cluster) that share a very similar plasmid whereas other closely related strains (e.g. Paris, ST5 and ST152) have different plasmid content.